View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15481_low_43 (Length: 212)
Name: NF15481_low_43
Description: NF15481
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15481_low_43 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 77; Significance: 6e-36; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 77; E-Value: 6e-36
Query Start/End: Original strand, 15 - 91
Target Start/End: Original strand, 15454611 - 15454687
Alignment:
| Q |
15 |
cagagaaagctgaaattggtactagtggtttctaactgtacactgtacagtgagatcagtgtttcgtgctttgtacc |
91 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15454611 |
cagagaaagctgaaattggtactagtggtttctaactgtacactgtacagtgagatcagtgtttcgtgctttgtacc |
15454687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 66; E-Value: 2e-29
Query Start/End: Original strand, 132 - 197
Target Start/End: Original strand, 15454728 - 15454793
Alignment:
| Q |
132 |
atggttgtttgttaaggtttttaatgtcaaattaaagccacctatgaaattaagaaagatgtatgt |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15454728 |
atggttgtttgttaaggtttttaatgtcaaattaaagccacctatgaaattaagaaagatgtatgt |
15454793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University