View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15483_low_16 (Length: 208)
Name: NF15483_low_16
Description: NF15483
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15483_low_16 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 88; Significance: 2e-42; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 21 - 116
Target Start/End: Complemental strand, 16127978 - 16127883
Alignment:
| Q |
21 |
gggaggagtggtggcggtgagttgcggtgggccgctgagggagtggcgacgtgaggacattgtcgtcttttcgtgaggttagtgtcttagcattcg |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
16127978 |
gggaggagtggtggcggtgagttgcggtgggccgctgagggagtggcgacgtgaggacattgtcgtcttttcgtgaggttagtgtctcggcattcg |
16127883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 142 - 186
Target Start/End: Complemental strand, 16127857 - 16127813
Alignment:
| Q |
142 |
cggtggtgaaggagtgttgagagtgtgtgaaacggtgcgttttgt |
186 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
16127857 |
cggtggtgaaggggtgttgagagtgtgtgaaacggtgcgttttgt |
16127813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University