View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15483_low_6 (Length: 403)
Name: NF15483_low_6
Description: NF15483
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15483_low_6 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 86; Significance: 5e-41; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 86; E-Value: 5e-41
Query Start/End: Original strand, 17 - 102
Target Start/End: Complemental strand, 3434654 - 3434569
Alignment:
| Q |
17 |
cttcttcttatgatgatcattgcagtatgcactttactttgtgtaccttggccttgttgtttgtatatcatcttatgcaggtatgt |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3434654 |
cttcttcttatgatgatcattgcagtatgcactttactttgtgtaccttggccttgttgtttgtatatcatcttatgcaggtatgt |
3434569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 74; E-Value: 8e-34
Query Start/End: Original strand, 320 - 393
Target Start/End: Complemental strand, 3434342 - 3434269
Alignment:
| Q |
320 |
catacttgtgtcattttcttcctttcacttgtcaatattgcctaacattatctaagaaaattccattcttctca |
393 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3434342 |
catacttgtgtcattttcttcctttcacttgtcaatattgcctaacattatctaagaaaattccattcttctca |
3434269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 188 - 246
Target Start/End: Complemental strand, 3434474 - 3434416
Alignment:
| Q |
188 |
cctaacatgtgaagaagattggttaaacttgcttgcaggaccataaacttttcttagtc |
246 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3434474 |
cctaacatgtgaagaagattggttaaacttgcttgcaggaccataaacttttcttagtc |
3434416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University