View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15485_high_2 (Length: 606)

Name: NF15485_high_2
Description: NF15485
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15485_high_2
NF15485_high_2
[»] chr8 (1 HSPs)
chr8 (3-177)||(29170205-29170380)


Alignment Details
Target: chr8 (Bit Score: 124; Significance: 2e-63; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 124; E-Value: 2e-63
Query Start/End: Original strand, 3 - 177
Target Start/End: Original strand, 29170205 - 29170380
Alignment:
3 aacctgatctagga-ttgtatcaaacaccttgaaggcttgttcttcatcaagcagttttgtctgcgttggaccagtacaaaccctggtttgagcatccaa 101  Q
    ||||||||||| || |||||||||||||||||||||||||||||||||||||| |||| || ||||||||||||||||||||||||||||||||||||||    
29170205 aacctgatctaagaattgtatcaaacaccttgaaggcttgttcttcatcaagcggtttggtttgcgttggaccagtacaaaccctggtttgagcatccaa 29170304  T
102 cgccgtttgatttggcctagtcaatttcgaactccgataccaagacgacaatgaaggattctgaacgtcgaattcc 177  Q
    | | |||||||| ||||||||||||||||||||||||||| |||||||||| ||||||||| ||| ||||||||||    
29170305 cacagtttgattcggcctagtcaatttcgaactccgatacgaagacgacaacgaaggattccgaaagtcgaattcc 29170380  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University