View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15485_low_17 (Length: 349)
Name: NF15485_low_17
Description: NF15485
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15485_low_17 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 146; Significance: 7e-77; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 146; E-Value: 7e-77
Query Start/End: Original strand, 13 - 162
Target Start/End: Original strand, 5323348 - 5323497
Alignment:
| Q |
13 |
aatatgtcttaatgacacttctctttcaccaaaatatatcattcatgtggaaaaccatgtggatgaggcgacaattagataaaattcaacaacgtagatt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5323348 |
aatatgtcttaatgacacttctctttcaccaaaatatatcattcatgtggaaaaccatgtggatgaggcgacaattagataaaattcaacaacgtagatt |
5323447 |
T |
|
| Q |
113 |
ttggtgtgaaactagcaataaatttacgaggggctaaacatacaagaagg |
162 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
5323448 |
ttggtgtgaaactagcaataaatttacgaggggctaaacatataagaagg |
5323497 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 229 - 334
Target Start/End: Original strand, 5323646 - 5323751
Alignment:
| Q |
229 |
tgttgattttaactatgctttaaggagtcagatttatctatctataattgataaatttaaactaaaacaacacnnnnnnntgacaaataaccaaggtcgt |
328 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
5323646 |
tgttgattttaactatgctttaaggagtcagatttatctatctataattgataaatttaaactaaaacaacacaaaaaaatgacaaataaccaaggtcgt |
5323745 |
T |
|
| Q |
329 |
ccaaat |
334 |
Q |
| |
|
|||||| |
|
|
| T |
5323746 |
ccaaat |
5323751 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University