View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15485_low_2 (Length: 606)
Name: NF15485_low_2
Description: NF15485
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15485_low_2 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 124; Significance: 2e-63; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 124; E-Value: 2e-63
Query Start/End: Original strand, 3 - 177
Target Start/End: Original strand, 29170205 - 29170380
Alignment:
| Q |
3 |
aacctgatctagga-ttgtatcaaacaccttgaaggcttgttcttcatcaagcagttttgtctgcgttggaccagtacaaaccctggtttgagcatccaa |
101 |
Q |
| |
|
||||||||||| || |||||||||||||||||||||||||||||||||||||| |||| || |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29170205 |
aacctgatctaagaattgtatcaaacaccttgaaggcttgttcttcatcaagcggtttggtttgcgttggaccagtacaaaccctggtttgagcatccaa |
29170304 |
T |
 |
| Q |
102 |
cgccgtttgatttggcctagtcaatttcgaactccgataccaagacgacaatgaaggattctgaacgtcgaattcc |
177 |
Q |
| |
|
| | |||||||| ||||||||||||||||||||||||||| |||||||||| ||||||||| ||| |||||||||| |
|
|
| T |
29170305 |
cacagtttgattcggcctagtcaatttcgaactccgatacgaagacgacaacgaaggattccgaaagtcgaattcc |
29170380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University