View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15487_high_4 (Length: 245)
Name: NF15487_high_4
Description: NF15487
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15487_high_4 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 155; Significance: 2e-82; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 18 - 180
Target Start/End: Complemental strand, 41112859 - 41112697
Alignment:
| Q |
18 |
gtgctttattgataatgaacacaacaatatttaaccaagtggtcgttagtgaaaattagttggcactattcaaattcgatatctgattgtaataatctta |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41112859 |
gtgctttattgataatgaacacaacaatatttaaccaagtggtcgttagtgaaaattagttggcactattcaaattcgatatctgattgtaataatctta |
41112760 |
T |
 |
| Q |
118 |
gatgagaatttatttatcttctagtcgaatgcatgattaacaagaccatttcctttgataatt |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||| |
|
|
| T |
41112759 |
gatgagaatttatttatcttctagtcgaatgcatgattaacaggaccatttcctttgacaatt |
41112697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 201 - 245
Target Start/End: Complemental strand, 41112702 - 41112658
Alignment:
| Q |
201 |
acaatttattaatcctgtttattaatttgtagtgaatattgtcac |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41112702 |
acaatttattaatcctgtttattaatttgtagtgaatattgtcac |
41112658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University