View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15489_high_10 (Length: 365)
Name: NF15489_high_10
Description: NF15489
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15489_high_10 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 63; Significance: 3e-27; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 277 - 347
Target Start/End: Original strand, 20070230 - 20070300
Alignment:
| Q |
277 |
tttcaatggtttgtaggggtgaaagtataagtggtatcggtataagtagatctggttaaacgacatgttaa |
347 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
20070230 |
tttcaatggtttgtaggggttaaagtataagtggtatcggtataagtagatctggttaaacgaaatgttaa |
20070300 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University