View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15489_high_18 (Length: 299)
Name: NF15489_high_18
Description: NF15489
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15489_high_18 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 18 - 299
Target Start/End: Complemental strand, 43192441 - 43192165
Alignment:
| Q |
18 |
gttagcgccataattctggaaggatggaagaatattcgagtgnnnnnnnnnnnnnnncggctataataagataaagaaacacgcgtttggtttatgaaga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43192441 |
gttagcgccataattctggaaggatggaagaatattcgagtgatatatata------cgactataataagataaagaaacacgcgtttggtttatgaaga |
43192348 |
T |
|
| Q |
118 |
aatcgtagaggaggtggtggatgggaagtgaaagaaaactactatttggcagtgggaattccaacacctattgtctgagtctcactgcttttgtcc--gt |
215 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43192347 |
aatcgtagaggaggtggtggatgg-aagtgaaagaaaactactatttggcagtgggaattccaacacctattgtctgagtctcactgcttttgtcctata |
43192249 |
T |
|
| Q |
216 |
catcaacaatcatcaatcatactccgcccgacttcaattatataactcaaatacacacacaaaacaaaatagagtatattctca |
299 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43192248 |
tatcaacaatcatcaatcatactccgcccgacttcaattatataactcaaatacacacacaaaacaaaatagagtatattctca |
43192165 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University