View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15489_high_9 (Length: 368)
Name: NF15489_high_9
Description: NF15489
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15489_high_9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 99; Significance: 9e-49; HSPs: 5)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 99; E-Value: 9e-49
Query Start/End: Original strand, 17 - 126
Target Start/End: Complemental strand, 6453215 - 6453105
Alignment:
| Q |
17 |
atgaaggccgatgcacaagaggttgctgatgctgcaaagattacagttggtgctcacaaatgaatctatgtagcggggagctctcttaagtcttaa-tag |
115 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
6453215 |
atgaaggcagatgcacaagaggttgctgatgctgcaaagattacagttggtgctcacaaatgaatctatgtagcggggagctctcttaagtcttaagtag |
6453116 |
T |
 |
| Q |
116 |
ctatttgcaac |
126 |
Q |
| |
|
||||||||||| |
|
|
| T |
6453115 |
ctatttgcaac |
6453105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 69; E-Value: 7e-31
Query Start/End: Original strand, 206 - 278
Target Start/End: Complemental strand, 6463762 - 6463690
Alignment:
| Q |
206 |
tccttttcggatggtgttatatgattggttgtataccacctgcttgaaataagagactacaattttatctcaa |
278 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
6463762 |
tccttttcggatggtgttatatgattggttgtataccacctgcttgaaataagagacgacaattttatctcaa |
6463690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 206 - 274
Target Start/End: Complemental strand, 6453022 - 6452952
Alignment:
| Q |
206 |
tccttttcggatggtgttatatgattggttgtataccacctgcttgaaataa--gagactacaattttatc |
274 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
6453022 |
tccttttcggatggtgttatatgattggttgtataccacctgcttgaaataagagagactacaattttatc |
6452952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 30 - 107
Target Start/End: Complemental strand, 6463923 - 6463846
Alignment:
| Q |
30 |
cacaagaggttgctgatgctgcaaagattacagttggtgctcacaaatgaatctatgtagcggggagctctcttaagt |
107 |
Q |
| |
|
||||||||| ||||||||||| ||||| ||||| |||||||||||||||||||||||| | ||||||||||||||||| |
|
|
| T |
6463923 |
cacaagaggctgctgatgctgtaaagagtacagatggtgctcacaaatgaatctatgtggtggggagctctcttaagt |
6463846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 29 - 109
Target Start/End: Complemental strand, 44942308 - 44942228
Alignment:
| Q |
29 |
gcacaagaggttgctgatgctgcaaagattacagttggtgctcacaaatgaatctatgtagcggggagctctcttaagtct |
109 |
Q |
| |
|
|||||||||| ||||||||||| |||| || |||||||||||| |||||||||||| ||| || |||||||||||||||| |
|
|
| T |
44942308 |
gcacaagaggctgctgatgctgttaagaatagagttggtgctcaaaaatgaatctatatagtggagagctctcttaagtct |
44942228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 29 - 106
Target Start/End: Original strand, 52951139 - 52951216
Alignment:
| Q |
29 |
gcacaagaggttgctgatgctgcaaagattacagttggtgctcacaaatgaatctatgtagcggggagctctcttaag |
106 |
Q |
| |
|
|||| |||||||||||| || | ||| | ||||| ||||||||||||||||||||||| ||||| ||| ||||||||| |
|
|
| T |
52951139 |
gcacgagaggttgctgacgcagtaaaaagtacagatggtgctcacaaatgaatctatgaagcggagagttctcttaag |
52951216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University