View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15489_low_10 (Length: 368)

Name: NF15489_low_10
Description: NF15489
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15489_low_10
NF15489_low_10
[»] chr7 (5 HSPs)
chr7 (17-126)||(6453105-6453215)
chr7 (206-278)||(6463690-6463762)
chr7 (206-274)||(6452952-6453022)
chr7 (30-107)||(6463846-6463923)
chr7 (29-109)||(44942228-44942308)
[»] chr4 (1 HSPs)
chr4 (29-106)||(52951139-52951216)


Alignment Details
Target: chr7 (Bit Score: 99; Significance: 9e-49; HSPs: 5)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 99; E-Value: 9e-49
Query Start/End: Original strand, 17 - 126
Target Start/End: Complemental strand, 6453215 - 6453105
Alignment:
17 atgaaggccgatgcacaagaggttgctgatgctgcaaagattacagttggtgctcacaaatgaatctatgtagcggggagctctcttaagtcttaa-tag 115  Q
    |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||    
6453215 atgaaggcagatgcacaagaggttgctgatgctgcaaagattacagttggtgctcacaaatgaatctatgtagcggggagctctcttaagtcttaagtag 6453116  T
116 ctatttgcaac 126  Q
    |||||||||||    
6453115 ctatttgcaac 6453105  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 69; E-Value: 7e-31
Query Start/End: Original strand, 206 - 278
Target Start/End: Complemental strand, 6463762 - 6463690
Alignment:
206 tccttttcggatggtgttatatgattggttgtataccacctgcttgaaataagagactacaattttatctcaa 278  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||    
6463762 tccttttcggatggtgttatatgattggttgtataccacctgcttgaaataagagacgacaattttatctcaa 6463690  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 206 - 274
Target Start/End: Complemental strand, 6453022 - 6452952
Alignment:
206 tccttttcggatggtgttatatgattggttgtataccacctgcttgaaataa--gagactacaattttatc 274  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||  |||||||||||||||||    
6453022 tccttttcggatggtgttatatgattggttgtataccacctgcttgaaataagagagactacaattttatc 6452952  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 30 - 107
Target Start/End: Complemental strand, 6463923 - 6463846
Alignment:
30 cacaagaggttgctgatgctgcaaagattacagttggtgctcacaaatgaatctatgtagcggggagctctcttaagt 107  Q
    ||||||||| ||||||||||| ||||| ||||| |||||||||||||||||||||||| | |||||||||||||||||    
6463923 cacaagaggctgctgatgctgtaaagagtacagatggtgctcacaaatgaatctatgtggtggggagctctcttaagt 6463846  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 29 - 109
Target Start/End: Complemental strand, 44942308 - 44942228
Alignment:
29 gcacaagaggttgctgatgctgcaaagattacagttggtgctcacaaatgaatctatgtagcggggagctctcttaagtct 109  Q
    |||||||||| |||||||||||  |||| || |||||||||||| |||||||||||| ||| || ||||||||||||||||    
44942308 gcacaagaggctgctgatgctgttaagaatagagttggtgctcaaaaatgaatctatatagtggagagctctcttaagtct 44942228  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 29 - 106
Target Start/End: Original strand, 52951139 - 52951216
Alignment:
29 gcacaagaggttgctgatgctgcaaagattacagttggtgctcacaaatgaatctatgtagcggggagctctcttaag 106  Q
    |||| |||||||||||| || | ||| | ||||| ||||||||||||||||||||||| ||||| ||| |||||||||    
52951139 gcacgagaggttgctgacgcagtaaaaagtacagatggtgctcacaaatgaatctatgaagcggagagttctcttaag 52951216  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University