View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15489_low_11 (Length: 365)

Name: NF15489_low_11
Description: NF15489
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15489_low_11
NF15489_low_11
[»] chr4 (1 HSPs)
chr4 (277-347)||(20070230-20070300)


Alignment Details
Target: chr4 (Bit Score: 63; Significance: 3e-27; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 277 - 347
Target Start/End: Original strand, 20070230 - 20070300
Alignment:
277 tttcaatggtttgtaggggtgaaagtataagtggtatcggtataagtagatctggttaaacgacatgttaa 347  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||    
20070230 tttcaatggtttgtaggggttaaagtataagtggtatcggtataagtagatctggttaaacgaaatgttaa 20070300  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University