View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15489_low_27 (Length: 239)

Name: NF15489_low_27
Description: NF15489
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15489_low_27
NF15489_low_27
[»] chr4 (1 HSPs)
chr4 (19-237)||(52350908-52351123)
[»] chr5 (6 HSPs)
chr5 (33-180)||(30474337-30474484)
chr5 (74-216)||(30522589-30522731)
chr5 (74-216)||(30562929-30563071)
chr5 (71-216)||(30429948-30430091)
chr5 (57-206)||(30399051-30399200)
chr5 (163-219)||(30205602-30205658)


Alignment Details
Target: chr4 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 19 - 237
Target Start/End: Original strand, 52350908 - 52351123
Alignment:
19 accttcactaagcagaagggtggtaagacaatggaaactagatattggccttagtaactcactgttacatccaattacaatgaggtctttaagggatgga 118  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
52350908 accttcactaagcagaagggtggtaagacaatggaaactagatattggccttagtaactgactgttacatccaattacaatgaggtctttaagggatgga 52351007  T
119 aggaattgcaacacaagtttagggcaaccacaaatggtcaaatcagaaagacgagggaacatctcccccctttccattttcaataaccgttcaaagtttg 218  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||   |||||||||||| ||||||||||||||||||||||||||||||||    
52351008 aggaattgcaacacaagtttagggcaaccacaaatggtcaaatcagaaagac---ggaacatctcccgcctttccattttcaataaccgttcaaagtttg 52351104  T
219 gcaaacctagtaacgagac 237  Q
    ||||||||||||| |||||    
52351105 gcaaacctagtaatgagac 52351123  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 72; Significance: 7e-33; HSPs: 6)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 33 - 180
Target Start/End: Original strand, 30474337 - 30474484
Alignment:
33 gaagggtggtaagacaatggaaactagatattggccttagtaactcactgttacatccaattacaatgaggtctttaagggatggaaggaattgcaacac 132  Q
    ||||||||||||||| |  |||| | || ||||  || ||||||||| |||||||||||| |||||||||||||||||||||||||||| || |||||||    
30474337 gaagggtggtaagactacagaaattggagattgatctcagtaactcattgttacatccaaatacaatgaggtctttaagggatggaaggcatggcaacac 30474436  T
133 aagtttagggcaaccacaaatggtcaaatcagaaagacgagggaacat 180  Q
    ||||||||||||| ||  ||||||||||| ||||||| || |||||||    
30474437 aagtttagggcaatcaataatggtcaaattagaaagaagaaggaacat 30474484  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 74 - 216
Target Start/End: Complemental strand, 30522731 - 30522589
Alignment:
74 aactcactgttacatccaattacaatgaggtctttaagggatggaaggaattgcaacacaagtttagggcaaccacaaatggtcaaatcagaaagacgag 173  Q
    |||||| |||||||||||  ||||||||| |||||||  |||| ||||  | ||||| |||||||||||||||||   |||| ||| | |||||| || |    
30522731 aactcattgttacatccatctacaatgagttctttaaacgatgaaaggtgtggcaacccaagtttagggcaaccaacgatggccaacttagaaaggcggg 30522632  T
174 ggaacatctcccccctttccattttcaataaccgttcaaagtt 216  Q
    | || ||||||||  |||||| |||||| |||||||| |||||    
30522631 gaaaaatctcccctgtttccactttcaacaaccgttccaagtt 30522589  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 74 - 216
Target Start/End: Complemental strand, 30563071 - 30562929
Alignment:
74 aactcactgttacatccaattacaatgaggtctttaagggatggaaggaattgcaacacaagtttagggcaaccacaaatggtcaaatcagaaagacgag 173  Q
    |||||| |||||||||||  ||||||||| |||||||  |||| ||||  | ||||| |||||||||||||||||   |||| ||| | |||||| || |    
30563071 aactcattgttacatccatctacaatgagttctttaaacgatgaaaggtgtggcaacccaagtttagggcaaccaacgatggccaacttagaaaggcggg 30562972  T
174 ggaacatctcccccctttccattttcaataaccgttcaaagtt 216  Q
    | || ||||||||  |||||| |||||| |||||||| |||||    
30562971 gaaaaatctcccctgtttccactttcaacaaccgttccaagtt 30562929  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 71 - 216
Target Start/End: Original strand, 30429948 - 30430091
Alignment:
71 agtaactcactgttacatccaattacaatgaggtctttaagggatggaaggaattgcaacacaagtttagggcaaccacaaatggtcaaatcagaaagac 170  Q
    ||||||||| |||||||||||  ||||||||| |||||||  |||| |||| || ||||| |||||||| ||||||||  ||||| ||| | ||||||      
30429948 agtaactcattgttacatccatctacaatgagttctttaaaagatgaaaggcatggcaacccaagtttaaggcaaccaacaatggccaacttagaaaggt 30430047  T
171 gagggaacatctcccccctttccattttcaataaccgttcaaagtt 216  Q
    | || || ||||  ||| |||||| |||||| |||||||| |||||    
30430048 ggggaaaaatct--cccatttccactttcaacaaccgttccaagtt 30430091  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 57 - 206
Target Start/End: Original strand, 30399051 - 30399200
Alignment:
57 tagatattggccttagtaactcactgttacatccaattacaatgaggtctttaagggatggaaggaattgcaacacaagtttagggcaaccacaaatggt 156  Q
    |||| |||| ||| ||||||||| |||||||||| | ||||  ||||  |||||| ||||||||  || |||   |||||||||||||| |    ||  |    
30399051 tagagattgacctcagtaactcattgttacatcccaatacatagagggatttaagagatggaagacatggcactccaagtttagggcaagctgtgattct 30399150  T
157 caaatcagaaagacgagggaacatctcccccctttccattttcaataacc 206  Q
    ||| |||||||||| ||| ||||||||||| ||||||| |||||||||||    
30399151 caactcagaaagacaaggaaacatctcccctctttccactttcaataacc 30399200  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 163 - 219
Target Start/End: Original strand, 30205602 - 30205658
Alignment:
163 agaaagacgagggaacatctcccccctttccattttcaataaccgttcaaagtttgg 219  Q
    |||||||| ||| |||||||| || ||||||| ||||||||||| ||| ||||||||    
30205602 agaaagacaaggaaacatctcacctctttccactttcaataacccttctaagtttgg 30205658  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University