View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15489_low_4 (Length: 561)
Name: NF15489_low_4
Description: NF15489
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15489_low_4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 194; Significance: 1e-105; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 275 - 484
Target Start/End: Original strand, 6921170 - 6921378
Alignment:
| Q |
275 |
tctttcaaactcacctaagcttttcccctttttctttcaaatttatgatggctgcatcttcattttcatattctccatcttcaaaactatgtttgatctt |
374 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6921170 |
tctttcaaactcaccta-gcttttcccctttttctctcaaatttatgatggctgcatcttcattttcatattctccatcttcaaaactatgtttgatctt |
6921268 |
T |
 |
| Q |
375 |
ccccctcttcctttacacaacccaacaaaccctccctttctataaactcatttgaatcctcaaatcccaaccccatctcagctcaatctttgagttccct |
474 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6921269 |
ccccctcttcctttacacaacccaacaaaccctccctttctataaactcatttgaatcctcaaatcccaaccccatctcagctcaatctttgagttcccc |
6921368 |
T |
 |
| Q |
475 |
catatatatc |
484 |
Q |
| |
|
|||||||||| |
|
|
| T |
6921369 |
catatatatc |
6921378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 73; E-Value: 4e-33
Query Start/End: Original strand, 140 - 236
Target Start/End: Original strand, 6920961 - 6921057
Alignment:
| Q |
140 |
agtactcattttgatatctaaacttaagaggtattacaaaggaatgagtgaatgacacttccataagaaaatattaaatattcattaaaatatgtag |
236 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||| |||| ||||||||| | ||||||||||| |||||||||||||||||| |
|
|
| T |
6920961 |
agtactcattttgatatctaaaattaagaggtattacaaaggaatgagtaaatggcacttccatgaaaaaatattaaaaattcattaaaatatgtag |
6921057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 10 - 61
Target Start/End: Original strand, 6920344 - 6920395
Alignment:
| Q |
10 |
agaagaagaagaatgtgtaatgatgttgtgttttgtgtttttcaattttaac |
61 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
6920344 |
agaagaagaagaatgtgtaatgttgttgtgttttgtgtttttcaattttaac |
6920395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 71 - 115
Target Start/End: Original strand, 6920417 - 6920461
Alignment:
| Q |
71 |
tgtgtgtaagattttttgtttgattaatgatgatgcttttttaat |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
6920417 |
tgtgtgtaagattttttgtttgattaatgatgatgtttttttaat |
6920461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University