View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1548_low_11 (Length: 376)
Name: NF1548_low_11
Description: NF1548
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1548_low_11 |
 |  |
|
| [»] scaffold0022 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr6 (Bit Score: 311; Significance: 1e-175; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 311; E-Value: 1e-175
Query Start/End: Original strand, 19 - 366
Target Start/End: Complemental strand, 1399865 - 1399518
Alignment:
| Q |
19 |
aacaccactgcatatatatttttattttggcatacttgtctgagttgtcgtatggatgttgtatggatgtcagacaccgacgcatgtcaaccacaggaac |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
1399865 |
aacaccactgcatatatatttttattttggcatacttgtctgagttgttgtatggatgttgtacggatgtcagacaccgacgcatgtcaaccacaggaac |
1399766 |
T |
 |
| Q |
119 |
acgcccaatcctagagttgtttgtgcttcataggtttttaattactttggatcagtttgcnnnnnnntttatatcggtttggatctatctaaacactcgt |
218 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
1399765 |
acgcccaatcctagagttgttggtgcttcataggtttttaattactttggatcagtttgcgggggggtttatatcggtttggatctatctaaacactcgt |
1399666 |
T |
 |
| Q |
219 |
gctatgtactatcaacacttcagattgaatgcatgtgtcaggtgtctgacaccaacacgacactcttactatatgcactatcgacacttcataacataaa |
318 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1399665 |
actatgtactatcaacacttcagattgaatgcatgtgtcaggtgtctgacaccaacacgacactcttactatatgcactatcgacacttcataacataaa |
1399566 |
T |
 |
| Q |
319 |
actccagcaaatcaagtcataatcataaacatgctaaaattccatatt |
366 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1399565 |
actccagcaaatcaagtcataatcataaacatgctaaaattccatatt |
1399518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0022 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0022
Description:
Target: scaffold0022; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 233 - 281
Target Start/End: Complemental strand, 144241 - 144195
Alignment:
| Q |
233 |
acacttcagattgaatgcatgtgtcaggtgtctgacaccaacacgacac |
281 |
Q |
| |
|
||||||||||||| ||| |||| ||||||||||||||||||||||||| |
|
|
| T |
144241 |
acacttcagattgcatgaatgt--caggtgtctgacaccaacacgacac |
144195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University