View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1548_low_19 (Length: 276)
Name: NF1548_low_19
Description: NF1548
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1548_low_19 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 1 - 219
Target Start/End: Original strand, 30266381 - 30266596
Alignment:
| Q |
1 |
cccttaatcatatcacttacaccggatttttggtatttgaaaaacaaa-tcttttt-cctaccatatatcaccaccattgttcaaattttactaaaccgc |
98 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30266381 |
cccttaatcatatcactcacaccggatttttgg-atttgaaaaacaaaatcttttttcctaccatatatcaccaccattgttcaaattttactaaaccgc |
30266479 |
T |
 |
| Q |
99 |
gtgaaaaagttgcatagtgagtgagtgagtaaccacgttcacgttcatccaccttcacatgcacacagtttctataccttttctctcaaaacagttacct |
198 |
Q |
| |
|
||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30266480 |
gtgaaaaagttgcatggtgagtgagtga----ccacgttcacgttcatccaccttcacatgcacacagtttctataccttttctctcaaaacagttacct |
30266575 |
T |
 |
| Q |
199 |
cttttttgtattaataataca |
219 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
30266576 |
cttttttgtattaataataca |
30266596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University