View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1548_low_24 (Length: 247)
Name: NF1548_low_24
Description: NF1548
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1548_low_24 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 107; Significance: 9e-54; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 107; E-Value: 9e-54
Query Start/End: Original strand, 59 - 233
Target Start/End: Original strand, 8240803 - 8240977
Alignment:
| Q |
59 |
cttaacttgggtccttagggtacaagttagcataacccttttctttataaaattgcaacaatttgagnnnnnnnnaagtaatttcaactaaaaaggtcct |
158 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||| |||||| |
|
|
| T |
8240803 |
cttaacttgggtccttagggtacaagttagcataacccttttctttattaaattgcaacaatttgagttttttt-aagtaatttcaactaaaatggtcct |
8240901 |
T |
 |
| Q |
159 |
tttatatccacactttccgttcaaatataagaagaaagactctagatgtgggttccacaacatt-tgtttttcctt |
233 |
Q |
| |
|
|||||||||||||||||||| ||||||| ||| ||||||||||||||| |||||||||| ||| ||||||||||| |
|
|
| T |
8240902 |
tttatatccacactttccgtccaaatatgagaggaaagactctagatgcaggttccacaatattctgtttttcctt |
8240977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University