View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1548_low_25 (Length: 246)
Name: NF1548_low_25
Description: NF1548
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1548_low_25 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 95; Significance: 1e-46; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 126 - 236
Target Start/End: Complemental strand, 29948364 - 29948254
Alignment:
| Q |
126 |
agcttacgaggactgcaacaagcatcttgtatcaatgagacataggttggaaaccgggaaccgcatagtattaaaactaagaagacatagcaatccgcat |
225 |
Q |
| |
|
||||||||||||||||| |||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
29948364 |
agcttacgaggactgcagcaagtatcttgtatcaatgagacataggttggaaaccaggaaccgcatagtattaaaactaagaagacatagcaatctgcat |
29948265 |
T |
 |
| Q |
226 |
gttgtcctatg |
236 |
Q |
| |
|
||||||||||| |
|
|
| T |
29948264 |
gttgtcctatg |
29948254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University