View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1548_low_26 (Length: 245)
Name: NF1548_low_26
Description: NF1548
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1548_low_26 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 110; Significance: 2e-55; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 71 - 207
Target Start/End: Complemental strand, 15640669 - 15640530
Alignment:
| Q |
71 |
gtttatatatttgttttattgtcctacttgtataaaaaa---tattattgtcccaaatcgaaatattattcttgatcatattatacttcctaacaccgaa |
167 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15640669 |
gtttatatatttgttttattatcctacttgtataaaaaaaaatattattgtcccaaatcggaatattattcttgatcatattatacttcctaacaccgaa |
15640570 |
T |
|
| Q |
168 |
ctttaaattatcatggtcgcgttcttctgaaaatcataag |
207 |
Q |
| |
|
||||||||||||||||||||||| |||||| ||||||||| |
|
|
| T |
15640569 |
ctttaaattatcatggtcgcgtttttctgagaatcataag |
15640530 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University