View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1548_low_30 (Length: 236)
Name: NF1548_low_30
Description: NF1548
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1548_low_30 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 1 - 220
Target Start/End: Complemental strand, 30266388 - 30266167
Alignment:
| Q |
1 |
attaagggtagaagaacaagatccgatccaaaccaattaaataggttcgattttgttaacgtattctacgccataccattatattttgatttggatatcg |
100 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30266388 |
attaagggtagaagaacaagatcccatccaaaccaattaaataggttcgattttgttaacgtattctacgccataccattatattttgatttggatatcg |
30266289 |
T |
 |
| Q |
101 |
attttatcgtcatgttttatggaggttgtgtagctcaatg--nnnnnnnnnaaggaaagagaaaatttatttttgaaaaggtcaagaaagaatgtattaa |
198 |
Q |
| |
|
||||||||||| ||||||||||| |||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
30266288 |
attttatcgtcgtgttttatggatgttgtgtagctcaatgtttttttttttaaggaaagagaaattttatttttgaaaaggtcaagaaagaatgtattaa |
30266189 |
T |
 |
| Q |
199 |
aatggcatagtcataacacaag |
220 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
30266188 |
aatggcatagtcataacacaag |
30266167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University