View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1548_low_33 (Length: 236)
Name: NF1548_low_33
Description: NF1548
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1548_low_33 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 1 - 220
Target Start/End: Complemental strand, 8240555 - 8240334
Alignment:
| Q |
1 |
tttatcattacttgtaagtttttatgtcatttttcaaattatacat---tcatctttctttcctttcactttaaattttactcatgtcaaataactaaaa |
97 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
8240555 |
tttatcattacttgtaagtttttatgtcatttttcaaattatacttctttcatctttctttcctttcactttcaattttactcatgtcaaataactaaaa |
8240456 |
T |
|
| Q |
98 |
aatcatgtaactttcgatttcatttattccggttacattctttcctttcactttcagaatttacctctaccggttgtgcatgaaggatactcaatttaaa |
197 |
Q |
| |
|
| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
8240455 |
actcatgtaactttcgatttcatttattccagttacattctttcctttcactttcagaatttacctcta-cggttgtacatgaaggatactcaatttaaa |
8240357 |
T |
|
| Q |
198 |
tagactttgtatatctatggatt |
220 |
Q |
| |
|
|||||||||||||||||| |||| |
|
|
| T |
8240356 |
tagactttgtatatctatcgatt |
8240334 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University