View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1548_low_35 (Length: 226)
Name: NF1548_low_35
Description: NF1548
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1548_low_35 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 13 - 210
Target Start/End: Complemental strand, 46681495 - 46681298
Alignment:
| Q |
13 |
caaaggagaaaatgaccaatttttcagtgttcaaacgaataacaatgcaaggaatggtgtgaagagtgttttgcgtccaactagagtaacgattagttgt |
112 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46681495 |
caaaggagaaaatgaccaattttttagtgttcaaacgaataacaatgcaaggaatggtgtgaagagtgttttgcgtccaactagagtaacgattagttgt |
46681396 |
T |
 |
| Q |
113 |
cctgaaaagtgtgaggttgctgggaagcttgtgttgctacctgaaagttttaaagagttacttgaaattggatctaagaaatttggtatagttgctac |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46681395 |
cctgaaaagtgtgaggttgctgggaagcttgtgttgctacctgaaagttttaaagagttacttgaaattggatctaagaaatttggtatagttgctac |
46681298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University