View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1548_low_6 (Length: 459)
Name: NF1548_low_6
Description: NF1548
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1548_low_6 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 213; Significance: 1e-116; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 213; E-Value: 1e-116
Query Start/End: Original strand, 171 - 445
Target Start/End: Complemental strand, 32012615 - 32012344
Alignment:
| Q |
171 |
ataacaataataattatagggatgattttattggacctggatcaccaagttttagagaatattgtactgattatgattctgtggatagaaattctatggt |
270 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
32012615 |
ataacaataataattatagggatgattttattggacctggatcaccaagttttagagaatattgtactgattatgattctgtggatagaagttctatggt |
32012516 |
T |
|
| Q |
271 |
agattctaatgattatactgaatctgaagaaagcatgaagaatagtagtagtgagtaatatggcttttgtcatgtgnnnnnnnnaaattatattttcatc |
370 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||| |
|
|
| T |
32012515 |
agattctaatgattatactgaatctggagaaagcatgaagaatagtagtagtgag---tatggcttttgtcatgtgtttttttttaattatattttcatc |
32012419 |
T |
|
| Q |
371 |
aactgtttaatttgatatgattaactatgttagtttgtttaggttatgattcctaaactttattggtgataattg |
445 |
Q |
| |
|
||||||||||||| |||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
32012418 |
aactgtttaatttcatatgattaattatgttagtttgtttaggttaagattcctaaactttattggtgataattg |
32012344 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University