View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15490_low_2 (Length: 275)
Name: NF15490_low_2
Description: NF15490
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15490_low_2 |
 |  |
|
| [»] scaffold0009 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0009 (Bit Score: 176; Significance: 7e-95; HSPs: 2)
Name: scaffold0009
Description:
Target: scaffold0009; HSP #1
Raw Score: 176; E-Value: 7e-95
Query Start/End: Original strand, 46 - 257
Target Start/End: Original strand, 101899 - 102111
Alignment:
| Q |
46 |
atatagagttataatttgaaatcatattatattttcaatctcattatattagtatcataccaaacataaagtcttctgcaaagtacagacaaggcctcaa |
145 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
101899 |
atatagagttataatttgaaatcatattatattttcaatctcattatattggtatcataccaaacataaagtcttctgcaaagtacagacaaggcctcaa |
101998 |
T |
 |
| Q |
146 |
ggcttgaattaaatatgtatgcaaaactgaatagatgtttatac-nnnnnnngtgaattaaatatgtttccaaggtctttctgctaggtttacacattct |
244 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
101999 |
ggcttgaattaaatatgtatgcaaaactgaaaagatgtttatacaaaaaaaagtgaattaaatatgtttccaaggtctttctgctaggtttacacattct |
102098 |
T |
 |
| Q |
245 |
ttgtgcctataac |
257 |
Q |
| |
|
||||||||||||| |
|
|
| T |
102099 |
ttgtgcctataac |
102111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0009; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 101833 - 101883
Alignment:
| Q |
1 |
tcacaattgttcctcttctgggttg---ttaaaagtaaattaactataata |
48 |
Q |
| |
|
|||||||||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
101833 |
tcacaattgttcctctcctgggttgttattaaaagtaaattaactataata |
101883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University