View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15491_high_24 (Length: 347)
Name: NF15491_high_24
Description: NF15491
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15491_high_24 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 178; Significance: 6e-96; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 178; E-Value: 6e-96
Query Start/End: Original strand, 13 - 205
Target Start/End: Original strand, 38062564 - 38062754
Alignment:
| Q |
13 |
aatatatcgtttacctttgctttgcagctatatgagtattcaattccataaactgacattgcttttcctttcatcaaatatgtggctttacagtaatcac |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
38062564 |
aatatatcgtttacctttgctttgcagctatatgagtattcgattccataaactgacattgcttttcctttcatcaaatatgtggctttac--taatcac |
38062661 |
T |
 |
| Q |
113 |
aattaaaaccaaacaatgaaagtgtatatattgtctatatgttgtgacttttgacaacccatgaaggctgggtataccgtatacgtaccaacc |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38062662 |
aattaaaaccaaacaatgaaagtgtatatattgtctatatgttgtgacttttgacaacccatgaaggctgggtataccgtatacgtaccaacc |
38062754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 277 - 311
Target Start/End: Original strand, 38062806 - 38062840
Alignment:
| Q |
277 |
ctatggatcttgcagttcaaataattttgggagag |
311 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
38062806 |
ctatggatcttgcagttcaaataattttgggagag |
38062840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 229 - 259
Target Start/End: Original strand, 38062778 - 38062808
Alignment:
| Q |
229 |
ggcggatgaaagtaaggtttaaccatgacta |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
38062778 |
ggcggatgaaagtaaggtttaaccatgacta |
38062808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University