View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15491_high_30 (Length: 319)
Name: NF15491_high_30
Description: NF15491
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15491_high_30 |
 | |
|
| [»] chr6 (2 HSPs) |
| |
|
| [»] scaffold0168 (1 HSPs) |
| | |
|
Alignment Details
Target: chr6 (Bit Score: 189; Significance: 1e-102; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 106 - 319
Target Start/End: Original strand, 3434735 - 3434948
Alignment:
| Q |
106 |
ggataatccgagaagtgtctgtgcttcataggatcacatagatctgaaatggaaaaataattttgaatgaaatagaaaattttgaattttgttatacctt |
205 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3434735 |
ggataatccgagaagtgtttgtgcttcataggatcacatagatctgaaatggaaaaataattttgaatgaaatagaaaattttgaattttgttatacctt |
3434834 |
T |
|
| Q |
206 |
ggaaacttcatcagtcattttcttcaaatccatttggtttttaccaaaaccattaaccatttgaccaaagagaaggnnnnnnncaggcatagatgaacca |
305 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
3434835 |
ggaaacttcatcagtcattttcttcaaatccatttggtttttaccaaaaccattaaccatttgaccaaagagaaggaaaaaaacaggcatagatgaacca |
3434934 |
T |
|
| Q |
306 |
tgaataatggcacc |
319 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
3434935 |
tgaataatggcacc |
3434948 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 109 - 137
Target Start/End: Complemental strand, 20576600 - 20576572
Alignment:
| Q |
109 |
taatccgagaagtgtctgtgcttcatagg |
137 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
20576600 |
taatccgagaagtgtctgtgcttcatagg |
20576572 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0168 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: scaffold0168
Description:
Target: scaffold0168; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 109 - 137
Target Start/End: Original strand, 21380 - 21408
Alignment:
| Q |
109 |
taatccgagaagtgtctgtgcttcatagg |
137 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
21380 |
taatccgagaagtgtctgtgcttcatagg |
21408 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 109 - 137
Target Start/End: Original strand, 6247702 - 6247730
Alignment:
| Q |
109 |
taatccgagaagtgtctgtgcttcatagg |
137 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
6247702 |
taatccgagaagtgtctgtgcttcatagg |
6247730 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University