View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15491_high_34 (Length: 280)
Name: NF15491_high_34
Description: NF15491
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15491_high_34 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 260; Significance: 1e-145; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 1 - 280
Target Start/End: Complemental strand, 40931151 - 40930872
Alignment:
| Q |
1 |
ttgacgaggctttcgccgctttcgtcacatatagttttcatctttctaacttgtaaacgtcctccgcgaagccgtcgccgatcaaaacggtggtagcgcg |
100 |
Q |
| |
|
||||| ||||||||||||||| |||||||||||||||||| ||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
40931151 |
ttgacaaggctttcgccgcttccgtcacatatagttttcacctttcaaacttgtaaacgtcctccgcgaagccgacgccgatcaaaacggtggtagcgcg |
40931052 |
T |
 |
| Q |
101 |
ataattcatggtttcatctctaaatcaattgaatttctgtttggatctagattcgatcagttgttgtagcagtttctacaatatgttatcgccgctgttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40931051 |
ataattcatggtttcatctctaaatcaattgaatttctgtttggatctagattcgatcagttgttgtagcagtttctacaatatgttatcgccgctgttt |
40930952 |
T |
 |
| Q |
201 |
tgaagtttctgtttggatctagatttaatcagttgctggagcagtttttgtaagcggagatgaacagcttcttaaccgct |
280 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40930951 |
tgaagtttctgtttggatctagatttaatcagttgctggagcagtttttgtaagcggagatgaacagcttcttaaccgct |
40930872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 1 - 264
Target Start/End: Original strand, 33808172 - 33808435
Alignment:
| Q |
1 |
ttgacgaggctttcgccgctttcgtcacatatagttttcatctttctaacttgtaaacgtcctccgcgaagccgtcgccgatcaaaacggtggtagcgcg |
100 |
Q |
| |
|
||||| |||||||||||||| ||||||||| ||||| | ||||| | ||||||||||||||||||||||||| |||||||||| |||||||||||||| |
|
|
| T |
33808172 |
ttgacaaggctttcgccgctgccgtcacataaagtttcaacctttcaaccttgtaaacgtcctccgcgaagccgacgccgatcaagacggtggtagcgcg |
33808271 |
T |
 |
| Q |
101 |
ataattcatggtttcatctctaaatcaattgaatttctgtttggatctagattcgatcagttgttgtagcagtttctacaatatgttatcgccgctgttt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
33808272 |
ataattcatggtttcatctctaaatcaattgaatttctgtttggatctagattcgatcagttgttgtagcagtttctacaatatgttatcgccactgttt |
33808371 |
T |
 |
| Q |
201 |
tgaagtttctgtttggatctagatttaatcagttgctggagcagtttttgtaagcggagatgaa |
264 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33808372 |
tgaagattctgtttggatctagatttaatcagttgctggagcagtttttgtaagcggagatgaa |
33808435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University