View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15491_high_39 (Length: 248)
Name: NF15491_high_39
Description: NF15491
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15491_high_39 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 118; Significance: 3e-60; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 117 - 234
Target Start/End: Complemental strand, 25589393 - 25589276
Alignment:
| Q |
117 |
tatgtctgaacaaatgattttcttctttgtaatttttcccttccttggtaacagaaactatatacctggcattatgtaactagcctcatcctgatatgga |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25589393 |
tatgtctgaacaaatgattttcttctttgtaatttttcccttccttggtaacagaaactatatacctggcattatgtaactagcctcatcctgatatgga |
25589294 |
T |
 |
| Q |
217 |
acaaccaatgtaaattat |
234 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
25589293 |
acaaccaatgtaaattat |
25589276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University