View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15491_low_16 (Length: 432)
Name: NF15491_low_16
Description: NF15491
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15491_low_16 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 362; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 362; E-Value: 0
Query Start/End: Original strand, 1 - 406
Target Start/End: Complemental strand, 14878471 - 14878067
Alignment:
| Q |
1 |
tattcaatgcagtggattttcttctgatccattccaaatttcacatattttcctgactcattgatatacgatcaccgctcccaaaacatgtctgctttat |
100 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
14878471 |
tattcaatgcactggattttcttctgatccattccaaatttcacatattttcgtgactctttgatatacgatcaccgctcccaaaacatgtcttctttat |
14878372 |
T |
|
| Q |
101 |
aacttttttggcagtgttatcgacatgattttatcagttttcatctcttggttggagcacaatgaggtgttgttcttctattggtatcattctatagact |
200 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14878371 |
aacttttttggcagtgttatcgacattattttatcagttttcatctcttgtttggagcacaatgaggtgttgttcttctattggtatcattctatagact |
14878272 |
T |
|
| Q |
201 |
atttctttcattttgtatacacattacttgttttttataacaacttcttgattgctttcatgcaatgattatattagttttggaatattgttgttcacaa |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
14878271 |
atttctttcattttgtatacacattacttgttttttataacaacttcttgattgctttcatgcaatgattatattag-tttagaatattgttgttcacaa |
14878173 |
T |
|
| Q |
301 |
atataaacatatataggagagacgattcaccccttaacttttagagcaaagcttcaaggaaacgtgtaatggaaatacattgtttttatgtctaagaaat |
400 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
14878172 |
atataaacatatataggagagacgattcaccccttaacttttagagtaaagcttcaaggaaacgtgtaatggaaatatattgtttttatgtctaagaaat |
14878073 |
T |
|
| Q |
401 |
catatc |
406 |
Q |
| |
|
|||||| |
|
|
| T |
14878072 |
catatc |
14878067 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University