View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15491_low_48 (Length: 249)
Name: NF15491_low_48
Description: NF15491
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15491_low_48 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 8 - 230
Target Start/End: Complemental strand, 45676731 - 45676509
Alignment:
| Q |
8 |
tgatgtgtcacctttggtaggtaggacccaaagtagtattatgtggaatgtctcgtgaattagaaagtcagatatataaattcaaaatgacaatgtccaa |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45676731 |
tgatgtgtcacctttggtaggtaggacccaaagtagtattatgtggaatgtctcgtgaattagaaagtcagatatataaattcaaaatgacaatgtccaa |
45676632 |
T |
 |
| Q |
108 |
tcataactttttcttcctctccaaagtttccttcttctatttatttcactttctatatatcaacttgccattttatttctcaaaacctttttaacttcta |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
45676631 |
tcataactttttcttcctctccaaagtttccttcttctatttatttcactttctatatatcaacttgccattttatttctcaaaacatttttaacttcta |
45676532 |
T |
 |
| Q |
208 |
agttctaacccttcttcactact |
230 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
45676531 |
agttctaacccttcttcactact |
45676509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University