View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15491_low_52 (Length: 246)
Name: NF15491_low_52
Description: NF15491
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15491_low_52 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 11 - 229
Target Start/End: Complemental strand, 5221469 - 5221251
Alignment:
| Q |
11 |
cagagagttacacatacatgggacgaagtttcaacgaattctccatcaacgatgattcaacttcctccgctttcagcgactgcaacagtgacagatccgg |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5221469 |
cagagagttacacatacatgggacgaagtttcaacgaattctccatcaacgatgattcaacttcctccgctttcagcgactgcaacagtgacagatccgg |
5221370 |
T |
 |
| Q |
111 |
cgaattcgccaccacttcttctacctcccgacggctcttcctcgcctgcgcttccgaaaattccgatgacctcatccgtcaacttgtctccgatcttcac |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5221369 |
cgaattcgccaccacttcttctacctcccgacggctcttcctcgcctgcgcttccgaaaattccgatgacctcatccgtcaacttgtctccgatcttcac |
5221270 |
T |
 |
| Q |
211 |
tccgattcaatcgaagagc |
229 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
5221269 |
tccgattcaatcgaagagc |
5221251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 76 - 122
Target Start/End: Original strand, 47469431 - 47469477
Alignment:
| Q |
76 |
tccgctttcagcgactgcaacagtgacagatccggcgaattcgccac |
122 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||| |||| |
|
|
| T |
47469431 |
tccgctttcagcgactgcgacagtgacagatccaccgaattcaccac |
47469477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University