View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15491_low_61 (Length: 201)
Name: NF15491_low_61
Description: NF15491
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15491_low_61 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 159; Significance: 7e-85; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 159; E-Value: 7e-85
Query Start/End: Original strand, 19 - 185
Target Start/End: Complemental strand, 36686332 - 36686166
Alignment:
| Q |
19 |
gaacaacaaagcaaccaacaaaatgaactaaaatatctctaaaattacctctacaagaagcaagaccaaaggtaagcactcgctgaacggtctgtgttgc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
36686332 |
gaacaacaaagcaaccaacaaaatgaactaaaatatctctaaaattacctctacaagaagcaagaccaaaggtaagcactcgctgaaccgtctgtgttgc |
36686233 |
T |
|
| Q |
119 |
acttcatacaaaaaggagcaggcttcaatgaattaactagtagcgtgacaagagcttttcttgtata |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
36686232 |
acttcatacaaaaaggagcaggcttcaatgaattaactagtaacgtgacaagagcttttcttgtata |
36686166 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University