View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15492_low_5 (Length: 252)
Name: NF15492_low_5
Description: NF15492
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15492_low_5 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 212
Target Start/End: Original strand, 8859752 - 8859960
Alignment:
| Q |
1 |
taaaaggaaagaaaaagtaactttagaattaaacaatgagggaaaaagacaagcttcaatcaagtatgacacttgttgcctatttccgtagaaacaaaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8859752 |
taaaaggaaagaaaaagtaactttagaattaaacaatgagggaaaaagacaagcttcaatcaagtatgacacttgttgcctatttccgtagaaacaaaaa |
8859851 |
T |
|
| Q |
101 |
caagggaagaagaatgaatatggttttggtagaattggtggtaatgttcagatttaattaaattttgttgaaatccgatcatttagtaatctctacacaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8859852 |
caagggaagaagaatgaatatggttttggtagaat---tggtaatgttcagatttaattaaattttgttgaaatccgatcatttagtaatctctacacaa |
8859948 |
T |
|
| Q |
201 |
acaacaaaatct |
212 |
Q |
| |
|
|||||||||||| |
|
|
| T |
8859949 |
acaacaaaatct |
8859960 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University