View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15492_low_6 (Length: 251)
Name: NF15492_low_6
Description: NF15492
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15492_low_6 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 11 - 251
Target Start/End: Original strand, 8859466 - 8859710
Alignment:
| Q |
11 |
cagagataatcgaatatcaaaccttccgtctcaagctaataccacaagaacgatctaggcga-ttcataatttacgacacttataaattatcccaaccta |
109 |
Q |
| |
|
||||||||||||||||| ||| ||||| ||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8859466 |
cagagataatcgaatatgaaatcttccatctcaagctaataccacaagaccgatctaggcgaattcataatttacgacacttataaattatcccaaccta |
8859565 |
T |
 |
| Q |
110 |
ggtgcgctagacccgatggt---gggatcccattttaaacagctgacatagcatgttttaaaagggaggaagatccaccaaaccttgtactgacaacaag |
206 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8859566 |
ggtgcgctagacccgatggtatggggatcccattttaaacagctgacatagcatgttttaaaagggaggaagatccaccaaaccttgtactgacaacaag |
8859665 |
T |
 |
| Q |
207 |
catcttcacttacgataacttgtttggttcctacaaatgcatttt |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8859666 |
catcttcacttacgataacttgtttggttcctacaaatgcatttt |
8859710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University