View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15494_low_3 (Length: 253)
Name: NF15494_low_3
Description: NF15494
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15494_low_3 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 18 - 240
Target Start/End: Original strand, 3565777 - 3566000
Alignment:
| Q |
18 |
taatcaatgttgagaaagaagttatcaatgttgaggaattacctggaaatgataagaatgataaggaacaagaggaggtgcagtcta-tgtgaagactcc |
116 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
3565777 |
taatcaatgtcgagaaagaagttatcaatgttgaggaattggctggaaatgataagaatgataaggaacaagaggaggtgcagtctaatgtgaagactcc |
3565876 |
T |
|
| Q |
117 |
tgacaaaaacacttcacctgctgaactgttaaaggcccaagatttgcaaatagaagtggaaataaaggccaacattcaagttaattatgttggagactta |
216 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||| |
|
|
| T |
3565877 |
tgacaaaaacacttcacctgctgaactcttaaaggcccaagatttgcaaatagaagtggaaataaatgccaacattcaagttaattctgttggagactta |
3565976 |
T |
|
| Q |
217 |
gatgtgaatgcgcaagatgatact |
240 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
3565977 |
gatgtgaatgcgcaagatgatact |
3566000 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University