View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15495_high_10 (Length: 385)
Name: NF15495_high_10
Description: NF15495
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15495_high_10 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 332; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 332; E-Value: 0
Query Start/End: Original strand, 15 - 367
Target Start/End: Complemental strand, 37664199 - 37663847
Alignment:
| Q |
15 |
atgaatttagaagtcatgctacttgaaatcggaaagccaatttcatgacttannnnnnnaaatatgtgtaggttaaagtgtgttttaaagggagaagaaa |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37664199 |
atgaatttagaagtcatgctacttgaaatcggaaagccaatttcatgacttatttttttaaatatgtgtaggttaaagtgtgttttaaagggagaagaaa |
37664100 |
T |
 |
| Q |
115 |
atggcaactctagtcgatattggcgtttctgctggcatcaatctgttttccgcaactatgttccttttagcgtttgcagtgttgcgacttcagcctttca |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37664099 |
atggcaactctagtcgatattggcgtttctgctggcatcaatctgttttccgcaactatgttccttttagcgtttgcagtgttgcgacttcagcctttca |
37664000 |
T |
 |
| Q |
215 |
atgatagggtttacttcccaaaatggtatctgaaggggataagaagcagcccaacaaattccagatcaattgtcaagaaatttgttaaccttgactttgg |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37663999 |
atgatagggtttacttcccaaaatggtatctgaaggggataagaagcagcccaacaaattccagatcaattgtcaagaaatttgttaaccttgactttgg |
37663900 |
T |
 |
| Q |
315 |
aacctacattaggttcctcaattggatgcctgcagcattgcatatgcctgaac |
367 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37663899 |
aacctacattaggttcctcaattggatgcctgcagcattgcatatgcctgaac |
37663847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 202 - 251
Target Start/End: Complemental strand, 55427966 - 55427917
Alignment:
| Q |
202 |
cttcagcctttcaatgatagggtttacttcccaaaatggtatctgaaggg |
251 |
Q |
| |
|
||||||||||| ||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
55427966 |
cttcagcctttgaatgatagggtatacttcccaaaatggtatctcaaggg |
55427917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University