View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15495_high_30 (Length: 240)
Name: NF15495_high_30
Description: NF15495
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15495_high_30 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 2 - 224
Target Start/End: Complemental strand, 6080516 - 6080297
Alignment:
| Q |
2 |
ataatttttcaagagaacgagaaaagggggagagatggggaggggaaagtgtcggtttggcagtatttgcatcttactactgtgtcatgtttgaatcaac |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
6080516 |
ataatttttcaagagaacgagaaaagggggagagatagggaggggaaagtgtcggtttggctgtatttgcatcatactactgtgtcatgtttgaatcaac |
6080417 |
T |
 |
| Q |
102 |
aacatgtgtcatttgaccaagtagaacacaagacactcatctaccaccagtttatgtaccctggaccttaagtaactacgcaaccatcacatgcttaaaa |
201 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6080416 |
a---tgtgtcatttgaccaagtagaacacaagacactcatctaccaccagtttatgtaccctggaccttaagtaactacgcaaccatcacatgcttaaaa |
6080320 |
T |
 |
| Q |
202 |
tttaatgatactgtcatactact |
224 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
6080319 |
tttaatgatactgtcatactact |
6080297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University