View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15495_high_34 (Length: 233)
Name: NF15495_high_34
Description: NF15495
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15495_high_34 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 116; Significance: 4e-59; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 1 - 172
Target Start/End: Original strand, 41623922 - 41624080
Alignment:
| Q |
1 |
attacttatgtattttgttctgtgatcttaactagtaatcttgtttgttggatacaattgttttagagctatcataattgtatcttattataaataaacg |
100 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
41623922 |
attacttatgtattttgttgtgtgatcttaactagtaatcttgtttgt-------------tttagagctgtcataattgtatcttattataaataaacg |
41624008 |
T |
|
| Q |
101 |
aattaattaaagaattcatatcttgactaattatgtgaaatacaataatggaaggaaatctgtcaatattat |
172 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
41624009 |
aattaattaaagaattcatatcttgactaattatgtgaaatacaataatggaaggaaatctgtaaatattat |
41624080 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 192 - 228
Target Start/End: Original strand, 41624099 - 41624135
Alignment:
| Q |
192 |
ctcaatttgtaattatgtgatcttgagaataatctac |
228 |
Q |
| |
|
|||||||| |||||||||||||||||||| ||||||| |
|
|
| T |
41624099 |
ctcaatttctaattatgtgatcttgagaagaatctac |
41624135 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University