View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15495_high_39 (Length: 212)
Name: NF15495_high_39
Description: NF15495
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15495_high_39 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 13 - 191
Target Start/End: Original strand, 12694340 - 12694518
Alignment:
| Q |
13 |
ttatactgtatgatactccgaggggttatagtcaacggggaactgatttgtaagggaacataattttcgtacgatacttgtagtttgtgtgaaacttcaa |
112 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12694340 |
ttatattgtatgatactccgaggggttatagtcaatggggaactgatttgtaagggaacataattttcgtacgatacttgtagtttgtgtgaaacttcaa |
12694439 |
T |
|
| Q |
113 |
gtttgagattagttgctttgaatcatcgacaagtggtagttcgtgaggaccattgataatgtgttgcttggatagatct |
191 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
12694440 |
gtttgagattagttactttgaatcatcgacaagtggtagttcgtgaggaccattgataatgtgttgctttgatagatct |
12694518 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University