View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15495_low_18 (Length: 326)
Name: NF15495_low_18
Description: NF15495
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15495_low_18 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 279; Significance: 1e-156; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 279; E-Value: 1e-156
Query Start/End: Original strand, 16 - 310
Target Start/End: Original strand, 45383281 - 45383574
Alignment:
| Q |
16 |
atggtcggttgatgaaacgcaactgaggacgatggctgagctctttggcaggggtgttgtatatgcaaacactaaacgctcaagtcagtttttgagtgcg |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
45383281 |
atggtcggttgatgaaacgcaactgaggacgatggctgagctctttggcaggggtgttgtatatgcaaacactaa-cgctcaagtcagtttttgagtgcg |
45383379 |
T |
|
| Q |
116 |
gtgcatgagacgtttaacataatggaatgtgtatgtttatcctagctgaggtgtccttttataggtagagtttcaagagaattgagcaaaatttcgttga |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
45383380 |
gtgcatgagacgtttaacataatggaatgtgtatgtttatcctagctgaggtgtccttttataggtagagtttcaagagaattgagcaaaaattcgttga |
45383479 |
T |
|
| Q |
216 |
ggccgttgagagattctctgcatggttcgcggaacaacatcttatgttgattatgtgtgtgctgattgattgttggacggatacactcagacatg |
310 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45383480 |
ggccgttgagagattctctgcatggttcgcggaacaacatcttatgttgattatgtgcgtgctgattgattgttggacggatacactcagacatg |
45383574 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University