View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15495_low_20 (Length: 317)
Name: NF15495_low_20
Description: NF15495
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15495_low_20 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 167; Significance: 2e-89; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 1 - 175
Target Start/End: Complemental strand, 35228219 - 35228045
Alignment:
| Q |
1 |
acagtgactatagttggttatggcaccagtgatgatggtgtgaagtattggctagtgaaaaattcatggggtactaaatggggtgagaaaggatatatca |
100 |
Q |
| |
|
||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35228219 |
acagttactatagttggttatggtaccagtgatgatggtgtgaagtattggctagtgaaaaattcatggggtactaaatggggtgagaaaggatatatca |
35228120 |
T |
|
| Q |
101 |
agattaagagagacgtgcatgccaaggaaggttcatgtggaattgctatggttcccacttatccaattgtttaag |
175 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35228119 |
agattaagagagacgtgcatgccaaggaaggttcatgtggaattgctatggttcccacttatccaattgtttaag |
35228045 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 84; E-Value: 7e-40
Query Start/End: Original strand, 215 - 298
Target Start/End: Complemental strand, 35228046 - 35227963
Alignment:
| Q |
215 |
agtcttcttatactagtttgatgaattgcttgtgtttgaattagttatgtgtgtgagtgtttgaataaatagctagggtgtgta |
298 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35228046 |
agtcttcttatactagtttgatgaattgcttgtgtttgaattagttatgtgtgtgagtgtttgaataaatagctagggtgtgta |
35227963 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 44 - 92
Target Start/End: Complemental strand, 31176515 - 31176467
Alignment:
| Q |
44 |
agtattggctagtgaaaaattcatggggtactaaatggggtgagaaagg |
92 |
Q |
| |
|
|||||||| |||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
31176515 |
agtattggttagtaaaaaattcatggggtactgggtggggtgagaaagg |
31176467 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University