View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15495_low_23 (Length: 292)
Name: NF15495_low_23
Description: NF15495
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15495_low_23 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 242; Significance: 1e-134; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 18 - 279
Target Start/End: Complemental strand, 385053 - 384792
Alignment:
| Q |
18 |
acaacatctgcttaaagaatatatatatttccttccaattgctcatagggagggagagagatggatgtagagcatcacagcagcggcgaaggtccagcaa |
117 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
385053 |
acaacatcagcttaaagaatatatatatttccttccaattgctcatagggagggagagagatggatgtagagcatcacagcagcggcgaaggtccagcaa |
384954 |
T |
 |
| Q |
118 |
cgaacgatggatgttcaatctgtcacgaaaacttccaactcccatgtcaagcaaattgttctcactggttttgtgcaaactgtattatccaagtttggca |
217 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
384953 |
cgaacgatcgatgttcaatctgtcacgaaaacttccaactcccatgtcaagcaaattgttctcactggttttgtgcaaactgtattatccaagtttggca |
384854 |
T |
 |
| Q |
218 |
atattattctcctcttcagccttgcaaatgtcctctttgtcgtcatcctattaatcttcttc |
279 |
Q |
| |
|
||||| |||||||||||| ||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
384853 |
atattcttctcctcttcaaccttgcaaatgtcctctttgtcgtcgtcctattaatcttcttc |
384792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 116; E-Value: 5e-59
Query Start/End: Original strand, 99 - 278
Target Start/End: Complemental strand, 390352 - 390173
Alignment:
| Q |
99 |
agcggcgaaggtccagcaacgaacgatggatgttcaatctgtcacgaaaacttccaactcccatgtcaagcaaattgttctcactggttttgtgcaaact |
198 |
Q |
| |
|
||||| ||||||||| |||| |||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| || |||| |
|
|
| T |
390352 |
agcggagaaggtccaccaacaaacgatctatgttcaatctgtcacggaaacttccaactcccatgtcaagcaaattgttctcactggttttgcgctaact |
390253 |
T |
 |
| Q |
199 |
gtattatccaagtttggcaatattattctcctcttcagccttgcaaatgtcctctttgtcgtcatcctattaatcttctt |
278 |
Q |
| |
|
| || |||||||||||||| |||| |||||||||||| ||||||||||||||||| ||||||| ||||||||| |||||| |
|
|
| T |
390252 |
gcataatccaagtttggcagtattcttctcctcttcaaccttgcaaatgtcctctctgtcgtcgtcctattaaccttctt |
390173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University