View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15495_low_32 (Length: 239)

Name: NF15495_low_32
Description: NF15495
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15495_low_32
NF15495_low_32
[»] chr2 (1 HSPs)
chr2 (1-222)||(7092702-7092923)


Alignment Details
Target: chr2 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 7092923 - 7092702
Alignment:
1 tttactttaaatctcccttactcttgaaaatcatatgtaacacttttacaccgtagcaattgtaggctctaatactagctgactaatttctctaatgatt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||    
7092923 tttactttaaatctcccttactcttgaaaatcatatgtaacacttttacaccgtagcaattgtaggctctaatactagctggctaatttctctaatgatt 7092824  T
101 ttattgcagaaaagtaggataaactcaaaatagcatgcatgcgcatgaattttagtgaggatcatatgcttgtgcgtggagttaaaacagagcatgattg 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7092823 ttattgcagaaaagtaggataaactcaaaatagcatgcatgcgcatgaattttagtgaggatcatatgcttgtgcgtggagttaaaacagagcatgattg 7092724  T
201 gggaggatttgcctctgctctg 222  Q
    ||||||||||||||||||||||    
7092723 gggaggatttgcctctgctctg 7092702  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University