View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15495_low_34 (Length: 234)
Name: NF15495_low_34
Description: NF15495
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15495_low_34 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 95; Significance: 1e-46; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 78 - 176
Target Start/End: Complemental strand, 14222759 - 14222661
Alignment:
| Q |
78 |
ttgtaagagtgtgagggagtttctagcaaaggtgaaaccaaaagatccgttacttctcatcagaccttgttcccttcctttatctctgtcactaggttc |
176 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14222759 |
ttgtaagagtgtgagggagttcctagcaaaggtgaaaccaaaagatccgttacttctcatcagaccttgttcccttcctttatctctgtcactaggttc |
14222661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 95 - 170
Target Start/End: Complemental strand, 14232584 - 14232509
Alignment:
| Q |
95 |
agtttctagcaaaggtgaaaccaaaagatccgttacttctcatcagaccttgttcccttcctttatctctgtcact |
170 |
Q |
| |
|
|||| |||||| |||||||||||||||||||||||||| ||||||||||||||| |||| |||||||||||||||| |
|
|
| T |
14232584 |
agttcctagcagaggtgaaaccaaaagatccgttacttgtcatcagaccttgtttccttgctttatctctgtcact |
14232509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University