View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15495_low_38 (Length: 220)
Name: NF15495_low_38
Description: NF15495
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15495_low_38 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 155; Significance: 2e-82; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 17 - 204
Target Start/End: Complemental strand, 16462607 - 16462420
Alignment:
| Q |
17 |
gaacaattagtatcacaattatgtacctagcttctgattttgttgnnnnnnnggcagcaacgtcctctccaaaaacaagagaaaacatcgttgagcgagt |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16462607 |
gaacaattagtatcacaattatgtacctagcttctgattttgttgtttttttggcagcaacgtcctctccaaaaacaagagaaaacatcgttgagcgagt |
16462508 |
T |
 |
| Q |
117 |
aaggtttgagaagttaatgccaacaccctgacaagacaaacaaacggaaaattgaattaattttagatcaaatccgcgtccaatatcc |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||| ||||||| |
|
|
| T |
16462507 |
aaggtttgagaagttaatgccaacaccctgacaacacaaacaaacggaaaattgaattaattttagatcaaatgcgcgtctaatatcc |
16462420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 66; E-Value: 2e-29
Query Start/End: Original strand, 70 - 171
Target Start/End: Complemental strand, 16492494 - 16492393
Alignment:
| Q |
70 |
gcagcaacgtcctctccaaaaacaagagaaaacatcgttgagcgagtaaggtttgagaagttaatgccaacaccctgacaagacaaacaaacggaaaatt |
169 |
Q |
| |
|
|||||||| ||||||||||| ||||||||| |||||||||||| |||||||||||||||||||||||| ||||||||||| ||||||||| ||||||| |
|
|
| T |
16492494 |
gcagcaacttcctctccaaagacaagagaatgcatcgttgagcgtgtaaggtttgagaagttaatgccagcaccctgacaacacaaacaaagagaaaatt |
16492395 |
T |
 |
| Q |
170 |
ga |
171 |
Q |
| |
|
|| |
|
|
| T |
16492394 |
ga |
16492393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University