View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15498_high_2 (Length: 226)
Name: NF15498_high_2
Description: NF15498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15498_high_2 |
 | |
|
| [»] scaffold0045 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold0045 (Bit Score: 126; Significance: 4e-65; HSPs: 2)
Name: scaffold0045
Description:
Target: scaffold0045; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 25 - 187
Target Start/End: Complemental strand, 22611 - 22449
Alignment:
| Q |
25 |
tctaattctattttattcacaataatgcttttgatccttaggaatattctctgtctgatgnnnnnnnttgtaatttgacacaaaatagaaatttagtttt |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||| ||||||||||||||||||||||||||||| |
|
|
| T |
22611 |
tctaattctattttattcacaataatgcttttgatccttagggatattctctgtctgataaaaaaaattgcaatttgacacaaaatagaaatttagtttt |
22512 |
T |
|
| Q |
125 |
cctttacgatttctcttgcttgttcttttgtgtgtttcaaaaaatagaaattatgtctgatac |
187 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22511 |
cctttaagatttctcttgcttgttcttttgtgtgtttcaaaaaatagaaattatgtctgatac |
22449 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0045; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 115 - 168
Target Start/End: Complemental strand, 54484 - 54431
Alignment:
| Q |
115 |
atttagttttcctttacgatttctcttgcttgttcttttgtgtgtttcaaaaaa |
168 |
Q |
| |
|
|||||||||||||||| | |||||| || |||||||||||| |||||||||||| |
|
|
| T |
54484 |
atttagttttcctttaaggtttctcctgtttgttcttttgtatgtttcaaaaaa |
54431 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University