View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15499_low_6 (Length: 269)
Name: NF15499_low_6
Description: NF15499
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15499_low_6 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 116; Significance: 4e-59; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 34 - 169
Target Start/End: Complemental strand, 43664559 - 43664425
Alignment:
| Q |
34 |
atgatgcaatttgttttaggttttgaaatgattactgtcataaacttacaaccacaattttttgtatttgaaaataagtaaaaagggtataattatgttt |
133 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43664559 |
atgatgcaatttgttttaggttttgaaatgattactgtcataaacttacaaccacagttttttgtatttgaaaataagtaaaaagggtataattatgttt |
43664460 |
T |
 |
| Q |
134 |
gattaattattatagaaaaagtatataacttcaaat |
169 |
Q |
| |
|
|||||||| ||||||||||||||||||||| |||| |
|
|
| T |
43664459 |
gattaatt-gtatagaaaaagtatataactttaaat |
43664425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 165 - 250
Target Start/End: Complemental strand, 43664361 - 43664276
Alignment:
| Q |
165 |
caaatcgactatggttataattgtgtgcctattttaatatgtaatcatgcatatatttttatttaaccagtaatccactgattcaa |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43664361 |
caaatcgactatggttataattgtgtgcctattttaatatgtaatcatgcatatatttttatttaaccagtaatccactgattcaa |
43664276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University