View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15499_low_8 (Length: 250)
Name: NF15499_low_8
Description: NF15499
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15499_low_8 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 203; Significance: 1e-111; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 17 - 232
Target Start/End: Complemental strand, 32656877 - 32656660
Alignment:
| Q |
17 |
attgcttttcatgaacattcttctactagagatcaactatgttgaagccttcagagagcaaatattagcttgttatcatggggctcaactttgcaaactg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32656877 |
attgcttttcatgaacattcttctactagagatcaactatgttgaagccttcagagagcaaatattagcttgttatcatggggctcaactttgcaaactg |
32656778 |
T |
 |
| Q |
117 |
--gtggagatttcctttccctatcttttgggatttcctccatttccttcaccactcttcacccccactgcctctcaccttccacctccaacatccaacat |
214 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32656777 |
tggtggagatatcctttccctatcttttgggatttcctccatttccttcaccactcttcacccccactgcctctcaccttccacctccaacatccaacat |
32656678 |
T |
 |
| Q |
215 |
ggattccttccctatgcc |
232 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
32656677 |
ggattccttccctatgcc |
32656660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 21 - 155
Target Start/End: Complemental strand, 32630922 - 32630786
Alignment:
| Q |
21 |
cttttcatgaacattcttctactagagatcaactatgttgaagccttcagagagcaaatattagcttgttatcatggggctcaactttgcaaactg--gt |
118 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
32630922 |
cttttcattaacattcttctactagagatcaactatgttgaatccttcagagagcaaatattagcttgttatcatggggctcaactttgcaaactgctgt |
32630823 |
T |
 |
| Q |
119 |
ggagatttcctttccctatcttttgggatttcctcca |
155 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||| |
|
|
| T |
32630822 |
ggaggtttcctttccctatcttttgggatttcctcca |
32630786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 80 - 199
Target Start/End: Complemental strand, 32581665 - 32581553
Alignment:
| Q |
80 |
attagcttgttatcatggggctcaactttgcaaactg--gtggagatttcctttccctatcttttgggatttcctccatttccttcaccactcttcaccc |
177 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| || |||||| ||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
32581665 |
attagcttgttatcatggggctcaactttgcaaattgtggtggaggtttcctttccctatcttttgggatt---------tccttcaccactcttcactg |
32581575 |
T |
 |
| Q |
178 |
ccactgcctctcaccttccacc |
199 |
Q |
| |
|
||||||||| |||||||||||| |
|
|
| T |
32581574 |
ccactgcctatcaccttccacc |
32581553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 130 - 232
Target Start/End: Complemental strand, 41161095 - 41160990
Alignment:
| Q |
130 |
ttccctatcttttgggatttcctccatttccttcaccactcttcacccccactgcctctcacc---ttccacctccaacatccaacatggattccttccc |
226 |
Q |
| |
|
||||||||| ||||| ||||||||||||| || ||||||| ||||||||||||||||| ||||||| |||| |||| ||||||||||||||| |
|
|
| T |
41161095 |
ttccctatcctttggtatttcctccattttattaggatctcttcaaccccactgcctctcaccttgttccaccaccaatatcctgcatggattccttccc |
41160996 |
T |
 |
| Q |
227 |
tatgcc |
232 |
Q |
| |
|
| |||| |
|
|
| T |
41160995 |
tttgcc |
41160990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University