View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1549_low_18 (Length: 212)

Name: NF1549_low_18
Description: NF1549
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1549_low_18
NF1549_low_18
[»] chr2 (1 HSPs)
chr2 (1-198)||(15096590-15096787)


Alignment Details
Target: chr2 (Bit Score: 182; Significance: 1e-98; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 182; E-Value: 1e-98
Query Start/End: Original strand, 1 - 198
Target Start/End: Original strand, 15096590 - 15096787
Alignment:
1 gctcatcatgtgaactgtgaagttgaaagtttcggttcagttccaagctatttatagcatttgcattgcagtgacaatctttatctaacaacaaaagata 100  Q
    |||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
15096590 gctcctcatgtgaactgtgaagtttaaagtttcggttcagttccaagctatttatagcatttgcattgcagtgacaatctttatctaacaacaaaagata 15096689  T
101 aaagatagaacaagaaagaattataatgagcgttgcagctccaaaatctgtaacagaatcagcaacacctgaagctaaagtttcaggcattttcatat 198  Q
    |||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
15096690 aaagatagaacaagaaagaattataatgagtgttgcagcttcaaaatctgtaacagaatcagcaacacctgaagctaaagtttcaggcattttcatat 15096787  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University