View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15501_low_6 (Length: 320)
Name: NF15501_low_6
Description: NF15501
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15501_low_6 |
 | |
|
| [»] scaffold0311 (1 HSPs) |
| | |
|
Alignment Details
Target: chr1 (Bit Score: 265; Significance: 1e-148; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 265; E-Value: 1e-148
Query Start/End: Original strand, 18 - 309
Target Start/End: Complemental strand, 10898288 - 10897996
Alignment:
| Q |
18 |
gtttgaaattccataaacaattgattttggaaataatataatttcactaaaccggggcattataatcttatgaactcgcataagcacttatgaaactgtt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10898288 |
gtttgaaattccataaacaattgattttggaaatagtataatttcactaaactggggcattataatcttatgaactcgcataagcacttatgaaactgtt |
10898189 |
T |
|
| Q |
118 |
tgtaagagcttacataatcaatttatgatatattatgtattgataagttgtttttagcttatttccataaacactt-aaagtgaaatgcaaaatagattg |
216 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
10898188 |
tgtaagagcttacataagcaatttatgatatattatgtattgataagttgtttttagcttatttccataaacacttaaaagtgaaatgcaaaatagattg |
10898089 |
T |
|
| Q |
217 |
atacctttgatgatcggaataaggaatagaccttagaaggttaatctcttcaagtctcttttctcttcgttcttttgccttctccttcatctc |
309 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
10898088 |
atacctttggtgatcggaataaggaatagaccttagaaggttaatctcttcaagtctcttttctcttcgttcttttgccttctccttcttctc |
10897996 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 160 - 189
Target Start/End: Original strand, 55547054 - 55547083
Alignment:
| Q |
160 |
ataagttgtttttagcttatttccataaac |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
55547054 |
ataagttgtttttagcttatttccataaac |
55547083 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0311 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: scaffold0311
Description:
Target: scaffold0311; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 160 - 192
Target Start/End: Original strand, 10627 - 10659
Alignment:
| Q |
160 |
ataagttgtttttagcttatttccataaacact |
192 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |
|
|
| T |
10627 |
ataagttgttttcagcttatttccataaacact |
10659 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University